Review

cloning abemax p2a egfp sequence (Addgene inc)

Addgene inc is a verified supplier

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Addgene inc cloning abemax p2a egfp sequence
Cloning Abemax P2a Egfp Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 73 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cloning abemax p2a egfp sequence/product/Addgene inc
Average 94 stars, based on 73 article reviews

cloning abemax p2a egfp sequence - by Bioz Stars, 2026-04

94/100 stars

Images

Image Search Results

Transfection efficiency of hP2Y 12 R-HEK 293 cells and optimization of assay conditions for [ 3 H]AZ12464237 binding to membrane preparations of the same cells. (A) Relative qPCR analysis of the mRNA expression of hP2Y 12 R in WT (black bar) and transfected (blue-green bar) HEK 293 cells. (B) The eGFP expression of WT (black line) and transfected (blue-green line) HEK 293 cells as detected by flow cytometry. (C) Screening of binding buffers with different additives (as indicated in graph). Buffer was based on Na/K-phosphate (50 mM Na 2 HPO 4 /KH 2 PO 4 , 100 mM NaCl, 5 mM MgCl 2 , pH 7.4). BSA = Bovine serum albumin. (D) Screening of binding buffers with different additives (as indicated in graph). Buffer was based on Tris-HCl (50 mM Tris, 100 mM NaCl, 5 mM MgCl 2 , pH 7.4). (E) Screening of binding buffers with different additives (as indicated in graph). Buffer based on HEPES (50 mM HEPES, 100 mM NaCl, 5 mM MgCl 2 , pH 7.4) (F) Control experiments to determine the specificity of binding to hP2Y 12 R. Membranes prepared from HEK 293 cells transfected with the hP2X 7 R were used as a negative control. Blue-green bars represents total binding (TB), whereas pink and dark purple bars represent assessment of NSB by co-incubation with elinogrel (20 μM) and ticagrelor (10 μM), respectively. The binding buffer was Na/K-phosphate-based with 0.1% Tween-20. (G) Binding of [ 3 H]AZ12464237 with increasing amount of hP2Y 12 -HEK membranes (0.5–30 μg per 500 uL total volume in binding tube). Blue-green line represents TB and the pink line represents NSB determined with elinogrel (20 μM). The binding buffer was Na/K-phosphate-based with 0.1% Tween-20. (H) The influence of DMSO on binding of radioligand. Incubation of [ 3 H]AZ12464237 and hP2Y 12 R-HEK for 1 h at room temperature in the presence of different concentrations of DMSO (0.002%, 0.5%, 1%, 2%, 5% and 10%) of the total volume in the binding tube. The binding buffer was Na/K-phosphate-based with 0.1% Tween-20. NSB was assessed by co-incubation with elinogrel (20 μM). Data is presented as mean ± SEM form three different experiments and each data point has been carried out in triplicate. Significant difference was assessed by Student’s t -test (**** p -value <0.0001).

Journal: bioRxiv

Article Title: Characterization of [ 3 H]AZ12464237 as a high affinity, non-nucleotide antagonist radioligand for the P2Y12 receptor

doi: 10.1101/2024.10.10.617599

Figure Lengend Snippet: Transfection efficiency of hP2Y 12 R-HEK 293 cells and optimization of assay conditions for [ 3 H]AZ12464237 binding to membrane preparations of the same cells. (A) Relative qPCR analysis of the mRNA expression of hP2Y 12 R in WT (black bar) and transfected (blue-green bar) HEK 293 cells. (B) The eGFP expression of WT (black line) and transfected (blue-green line) HEK 293 cells as detected by flow cytometry. (C) Screening of binding buffers with different additives (as indicated in graph). Buffer was based on Na/K-phosphate (50 mM Na 2 HPO 4 /KH 2 PO 4 , 100 mM NaCl, 5 mM MgCl 2 , pH 7.4). BSA = Bovine serum albumin. (D) Screening of binding buffers with different additives (as indicated in graph). Buffer was based on Tris-HCl (50 mM Tris, 100 mM NaCl, 5 mM MgCl 2 , pH 7.4). (E) Screening of binding buffers with different additives (as indicated in graph). Buffer based on HEPES (50 mM HEPES, 100 mM NaCl, 5 mM MgCl 2 , pH 7.4) (F) Control experiments to determine the specificity of binding to hP2Y 12 R. Membranes prepared from HEK 293 cells transfected with the hP2X 7 R were used as a negative control. Blue-green bars represents total binding (TB), whereas pink and dark purple bars represent assessment of NSB by co-incubation with elinogrel (20 μM) and ticagrelor (10 μM), respectively. The binding buffer was Na/K-phosphate-based with 0.1% Tween-20. (G) Binding of [ 3 H]AZ12464237 with increasing amount of hP2Y 12 -HEK membranes (0.5–30 μg per 500 uL total volume in binding tube). Blue-green line represents TB and the pink line represents NSB determined with elinogrel (20 μM). The binding buffer was Na/K-phosphate-based with 0.1% Tween-20. (H) The influence of DMSO on binding of radioligand. Incubation of [ 3 H]AZ12464237 and hP2Y 12 R-HEK for 1 h at room temperature in the presence of different concentrations of DMSO (0.002%, 0.5%, 1%, 2%, 5% and 10%) of the total volume in the binding tube. The binding buffer was Na/K-phosphate-based with 0.1% Tween-20. NSB was assessed by co-incubation with elinogrel (20 μM). Data is presented as mean ± SEM form three different experiments and each data point has been carried out in triplicate. Significant difference was assessed by Student’s t -test (**** p -value <0.0001).

Article Snippet: Plasmid pcDNA3.1(+)-hP2Y 12 R-P2A-eGFP (hP2Y 12 R sequence access number NM_022788.4) and pcDNA3.1(+)-rP2Y 12 R -P2A-eGFP (rP2Y 12 R sequence access number NM_022800.1) were purchased from Genscript (Tokyo, Japan).

Techniques: Transfection, Binding Assay, Membrane, Expressing, Flow Cytometry, Control, Negative Control, Incubation

Characterization of [ 3 H]AZ12464237 binding to membrane preparations of HEK 293 cells transfected with the hP2Y 12 R. ( A ) Association studies performed with four different concentrations of [ 3 H]AZ12464237; 0.5 nM (filled circles), 1.5 nM (open circles), 5.0 nM (filled squares) and 15 nM (open squares). ( B ) The k obs values obtained from association data fitted to exponential one phase association plotted against the concentration of [ 3 H]AZ12464237. ( C ) Dissociation studies were performed by incubating [ 3 H]AZ12464237 (1.5 nM) with hP2Y 12 R-HEK for 1 h to reach equilibrium before dissociation by addition of elinogrel (20 μM) at different time points. ( D ) Saturation binding studies with increasing concentrations of [ 3 H]AZ12464237 (0.50–90 nM) in the presence or absence of elinogrel (20 μM) to assess NSB. The blue-green line represents TB, the black line corresponds to the specific binding (SB) and the pink line is the NSB. Graphs are representatives of three experiments and each data point has been carried out in triplicates.

Journal: bioRxiv

Article Title: Characterization of [ 3 H]AZ12464237 as a high affinity, non-nucleotide antagonist radioligand for the P2Y12 receptor

doi: 10.1101/2024.10.10.617599

Figure Lengend Snippet: Characterization of [ 3 H]AZ12464237 binding to membrane preparations of HEK 293 cells transfected with the hP2Y 12 R. ( A ) Association studies performed with four different concentrations of [ 3 H]AZ12464237; 0.5 nM (filled circles), 1.5 nM (open circles), 5.0 nM (filled squares) and 15 nM (open squares). ( B ) The k obs values obtained from association data fitted to exponential one phase association plotted against the concentration of [ 3 H]AZ12464237. ( C ) Dissociation studies were performed by incubating [ 3 H]AZ12464237 (1.5 nM) with hP2Y 12 R-HEK for 1 h to reach equilibrium before dissociation by addition of elinogrel (20 μM) at different time points. ( D ) Saturation binding studies with increasing concentrations of [ 3 H]AZ12464237 (0.50–90 nM) in the presence or absence of elinogrel (20 μM) to assess NSB. The blue-green line represents TB, the black line corresponds to the specific binding (SB) and the pink line is the NSB. Graphs are representatives of three experiments and each data point has been carried out in triplicates.

Techniques: Binding Assay, Membrane, Transfection, Concentration Assay

Displacement of [ 3 H]AZ12464237 binding to hP2Y 12 R-HEK using different P2Y ligands as competitors. ( A ) Chemical structures of elinogrel (P2Y 12 R antagonist), ticagrelor (P2Y 12 R antagonist), MRS2211 (P2Y 13 R antagonist) and PPTN·HCl (P2Y 14 R antagonist). ( B ) Representative curves obtained from competitive binding of [ 3 H]AZ12464237 and elinogrel (pink), ticagrelor (dark purple), MRS2211 (light blue) and PPTN·HCl (light pink) in concentrations ranging from 10 pM to 100 μM. Each experiment has been carried out in triplicates. Graphs are representatives of three experiments and each data point has been carried out in triplicates.

Journal: bioRxiv

Article Title: Characterization of [ 3 H]AZ12464237 as a high affinity, non-nucleotide antagonist radioligand for the P2Y12 receptor

doi: 10.1101/2024.10.10.617599

Figure Lengend Snippet: Displacement of [ 3 H]AZ12464237 binding to hP2Y 12 R-HEK using different P2Y ligands as competitors. ( A ) Chemical structures of elinogrel (P2Y 12 R antagonist), ticagrelor (P2Y 12 R antagonist), MRS2211 (P2Y 13 R antagonist) and PPTN·HCl (P2Y 14 R antagonist). ( B ) Representative curves obtained from competitive binding of [ 3 H]AZ12464237 and elinogrel (pink), ticagrelor (dark purple), MRS2211 (light blue) and PPTN·HCl (light pink) in concentrations ranging from 10 pM to 100 μM. Each experiment has been carried out in triplicates. Graphs are representatives of three experiments and each data point has been carried out in triplicates.

Techniques: Binding Assay

In vitro binding of [ 3 H]AZ12464237 to frozen sections of cell pellets obtained from hP2Y 12 R-overexpressing and control CHO cells. (A) Expression of P2Y 12 R (red) on sections from P2Y 12 R-overexpressing and control CHO cells, scale bar: 50 μm. (B) TB of [ 3 H]AZ12464237 (10 nM) and NSB in presence of AZ12464237, ticagrelor, cangrelor and a structurally unrelated compound (all at a 10 μM concentration) to P2Y 12 R overexpressing CHO cell pellets (top row) and control CHO cell pellets (bottom row). (C) Quantification of TB and NSB (expressed in fmol per mg of protein) to the P2Y 12 R overexpressing and control CHO sections. Representative graph of one experiment (experiment replicated three times).

Journal: bioRxiv

Article Title: Characterization of [ 3 H]AZ12464237 as a high affinity, non-nucleotide antagonist radioligand for the P2Y12 receptor

doi: 10.1101/2024.10.10.617599

Figure Lengend Snippet: In vitro binding of [ 3 H]AZ12464237 to frozen sections of cell pellets obtained from hP2Y 12 R-overexpressing and control CHO cells. (A) Expression of P2Y 12 R (red) on sections from P2Y 12 R-overexpressing and control CHO cells, scale bar: 50 μm. (B) TB of [ 3 H]AZ12464237 (10 nM) and NSB in presence of AZ12464237, ticagrelor, cangrelor and a structurally unrelated compound (all at a 10 μM concentration) to P2Y 12 R overexpressing CHO cell pellets (top row) and control CHO cell pellets (bottom row). (C) Quantification of TB and NSB (expressed in fmol per mg of protein) to the P2Y 12 R overexpressing and control CHO sections. Representative graph of one experiment (experiment replicated three times).

Techniques: In Vitro, Binding Assay, Control, Expressing, Concentration Assay

Binding studies of [ 3 H]AZ12464237 and competitors to membrane preparations of HEK 293 cells transfected with the rP2Y 12 R. ( A ) Transfection of HEK 293 cells with the rP2Y 12 R. Relative qPCR analysis of the mRNA expression of rP2Y 12 R in WT (black bar) and transfected (blue-green bar) HEK 293 cells. ( B ) Saturation binding studies with increasing concentrations of [ 3 H]AZ12464237 (0.50–150 nM) in the presence or absence of elinogrel (20 μM) to assess NSB. The blue-green line represents TB, the black line corresponds to the SB and the pink line is the NSB. ( C ) Competitive binding of [ 3 H]AZ12464237 with ticagrelor (dark purple) and elinogrel (pink), respectively in concentrations ranging from 10 pM to 100 μM. Graphs are representatives of three experiments and each data point has been carried out in triplicates.

Journal: bioRxiv

Article Title: Characterization of [ 3 H]AZ12464237 as a high affinity, non-nucleotide antagonist radioligand for the P2Y12 receptor

doi: 10.1101/2024.10.10.617599

Figure Lengend Snippet: Binding studies of [ 3 H]AZ12464237 and competitors to membrane preparations of HEK 293 cells transfected with the rP2Y 12 R. ( A ) Transfection of HEK 293 cells with the rP2Y 12 R. Relative qPCR analysis of the mRNA expression of rP2Y 12 R in WT (black bar) and transfected (blue-green bar) HEK 293 cells. ( B ) Saturation binding studies with increasing concentrations of [ 3 H]AZ12464237 (0.50–150 nM) in the presence or absence of elinogrel (20 μM) to assess NSB. The blue-green line represents TB, the black line corresponds to the SB and the pink line is the NSB. ( C ) Competitive binding of [ 3 H]AZ12464237 with ticagrelor (dark purple) and elinogrel (pink), respectively in concentrations ranging from 10 pM to 100 μM. Graphs are representatives of three experiments and each data point has been carried out in triplicates.

Techniques: Binding Assay, Membrane, Transfection, Expressing

( A ) Schematic of the one-vector CRISPR/Cas13b/d system construct (top) and the EGFP reporter construct (bottom). ( B ) Schematic of type VI-d (left) and VI-b (right) crRNA structures with the target RNA. The crRNAs carry a direct repeat sequence (blue) to facilitate the binding with their corresponding Cas13 enzyme, and a spacer sequence (red) specific for the target RNA, r(GGGGCC) n (purple). ( C and D ) The knockdown efficiency test in HEK293 cells via cotransfection of the CRISPR/Cas13d vector ( C ), or the CRISPR/Cas13b vector ( D ), and the reporter construct. Immunoblotting of EGFP showed the knockdown efficiency for different guide RNAs (gRNAs). Data are presented as means ± SD of 3 independent experiments and were analyzed with ordinary 1-way ANOVA with Dunnett’s multiple-comparison test. * P < 0.05, ** P < 0.01, *** P < 0.001.

Journal: The Journal of Clinical Investigation

Article Title: CRISPR/Cas13d targeting suppresses repeat-associated non-AUG translation of C9orf72 hexanucleotide repeat RNA

doi: 10.1172/JCI179016

Figure Lengend Snippet: ( A ) Schematic of the one-vector CRISPR/Cas13b/d system construct (top) and the EGFP reporter construct (bottom). ( B ) Schematic of type VI-d (left) and VI-b (right) crRNA structures with the target RNA. The crRNAs carry a direct repeat sequence (blue) to facilitate the binding with their corresponding Cas13 enzyme, and a spacer sequence (red) specific for the target RNA, r(GGGGCC) n (purple). ( C and D ) The knockdown efficiency test in HEK293 cells via cotransfection of the CRISPR/Cas13d vector ( C ), or the CRISPR/Cas13b vector ( D ), and the reporter construct. Immunoblotting of EGFP showed the knockdown efficiency for different guide RNAs (gRNAs). Data are presented as means ± SD of 3 independent experiments and were analyzed with ordinary 1-way ANOVA with Dunnett’s multiple-comparison test. * P < 0.05, ** P < 0.01, *** P < 0.001.

Article Snippet: Cas13d coding sequence was amplified from a plasmid (Addgene, 109049) using a forward primer introducing an NdeI site (TACCACATATGATCGAAAAAAAAAAGTCCTTCGCCAA) and a reverse primer introducing a BamHI site (TTGCAGGATCCTTAGGAATTGCCGGACACCTTCTTTTTCTC).

Techniques: Plasmid Preparation, CRISPR, Construct, Sequencing, Binding Assay, Knockdown, Cotransfection, Western Blot, Comparison

( A ) Schematic of the inducible luciferase-based C9orf72 RAN translation reporter system in HeLa Flp-In cells. ( B ) The reporter cells stably expressing Cas13d and gRNA S24 and S30 showed lower signals of NanoLuc and firefly luciferase signal from the (GGGGCC)70-containing reporter transcripts. The significant reduction of the NanoLuc luciferase signal relative to the firefly luciferase signal demonstrates that the repeat-associated RAN translation is inhibited by Cas13d-mediated S24 or S30 treatment. ( C ) The control cells harboring the reporter without the G4C2 repeat showed no effect of the Cas13d gRNAs on the translation of the reporters. ( D ) Immunoblot analysis of C9orf72 protein showed that the C9orf72 protein level was unaffected in HeLa RAN translation reporter cell lines stably expressing Cas13d-NT30, Cas13d-S24, and Cs13d-S30. ( E ) Transient cotransfection of CRISPR/Cas13d constructs with either the GA-frame, GP-frame, or GR-frame or the No-G4C2-repeat control construct in HEK293 cells showed that Cas13d-S24 and Cas13d-S30 significantly reduced both NanoLuc and firefly luciferase signals from the GA-, GP-, and GR-frame but not the negative No-G4C2-repeat control reporter compared with the non-targeting control Cas13d-NT30. ( F ) Immunoblot analysis of C9orf72 protein showed that the C9orf72 protein level was unaffected in HEK293 cells cotransfected with CRISPR/Cas13d and either the GA-frame, GP-frame, or GR-frame or the No-G4C2-repeat control construct. Data are presented as means ± SD of 3 or 4 biological replicates as indicated by the number of dots in each graph, and were analyzed with ordinary 1-way ANOVA with Dunnett’s multiple-comparison test. * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001.

Journal: The Journal of Clinical Investigation

Article Title: CRISPR/Cas13d targeting suppresses repeat-associated non-AUG translation of C9orf72 hexanucleotide repeat RNA

doi: 10.1172/JCI179016

Figure Lengend Snippet: ( A ) Schematic of the inducible luciferase-based C9orf72 RAN translation reporter system in HeLa Flp-In cells. ( B ) The reporter cells stably expressing Cas13d and gRNA S24 and S30 showed lower signals of NanoLuc and firefly luciferase signal from the (GGGGCC)70-containing reporter transcripts. The significant reduction of the NanoLuc luciferase signal relative to the firefly luciferase signal demonstrates that the repeat-associated RAN translation is inhibited by Cas13d-mediated S24 or S30 treatment. ( C ) The control cells harboring the reporter without the G4C2 repeat showed no effect of the Cas13d gRNAs on the translation of the reporters. ( D ) Immunoblot analysis of C9orf72 protein showed that the C9orf72 protein level was unaffected in HeLa RAN translation reporter cell lines stably expressing Cas13d-NT30, Cas13d-S24, and Cs13d-S30. ( E ) Transient cotransfection of CRISPR/Cas13d constructs with either the GA-frame, GP-frame, or GR-frame or the No-G4C2-repeat control construct in HEK293 cells showed that Cas13d-S24 and Cas13d-S30 significantly reduced both NanoLuc and firefly luciferase signals from the GA-, GP-, and GR-frame but not the negative No-G4C2-repeat control reporter compared with the non-targeting control Cas13d-NT30. ( F ) Immunoblot analysis of C9orf72 protein showed that the C9orf72 protein level was unaffected in HEK293 cells cotransfected with CRISPR/Cas13d and either the GA-frame, GP-frame, or GR-frame or the No-G4C2-repeat control construct. Data are presented as means ± SD of 3 or 4 biological replicates as indicated by the number of dots in each graph, and were analyzed with ordinary 1-way ANOVA with Dunnett’s multiple-comparison test. * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001.

Techniques: Luciferase, Stable Transfection, Expressing, Control, Western Blot, Cotransfection, CRISPR, Construct, Comparison

( A ) Schematic of RAN translation product detection in human iPSCs stably expressing Cas13d and gRNA via lentivirus transduction. ( B ) ELISA quantification in multiple C9-ALS patient iPSC cell lines showed significant reduction of poly-GP and poly-GA levels by Cas13d-S24 and CRISPR/S30 compared with the non-targeting control Cas13d-NT30. ( C ) Quantification of relative RNA levels of Cas13d in the C9-ALS patient iPSC cell lines showed variable Cas13d levels among lines, while in each line there were no significant differences among the S24, S30, and non-targeting NT30 groups. ( D and E ) Linear regression and correlation analyses showed a strong positive correlation between Cas13d expression level and poly-GP ( D ) and poly-GA ( E ) knockdown efficiency among C9-ALS patient iPSC lines. Pearson’s correlation coefficients and 2-tailed P value were computed. ( F ) Schematic of poly-GP and poly-GA detection in iMNs derived from human C9-ALS patient iPSCs. ( G ) ELISA quantification in iMN lines derived from multiple iPSC cell lines showed significant reduction in poly-GP and poly-GA levels by Cas13d-S24 and CRISPR/S30 compared with the non-targeting control Cas13d-NT30. ( H ) Quantification of relative RNA levels of Cas13d in the C9-ALS patient iMN lines showed variable Cas13d levels among lines, while in each line there were no significant differences among the S24, S30, and non-targeting NT30 groups. ( I and J ) Linear regression and correlation analyses showed a strong positive correlation between Cas13d expression level and poly-GP ( I ) and poly-GA ( J ) knockdown efficiency among C9-ALS patient iMN lines. Pearson’s correlation coefficients and 2-tailed P value were computed. Data are presented as means ± SD of 2–4 biological replicates as indicated by the number of dots in each graph, and were analyzed with ordinary 1-way ANOVA with Dunnett’s multiple-comparison test. * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001.

Journal: The Journal of Clinical Investigation

Article Title: CRISPR/Cas13d targeting suppresses repeat-associated non-AUG translation of C9orf72 hexanucleotide repeat RNA

doi: 10.1172/JCI179016

Figure Lengend Snippet: ( A ) Schematic of RAN translation product detection in human iPSCs stably expressing Cas13d and gRNA via lentivirus transduction. ( B ) ELISA quantification in multiple C9-ALS patient iPSC cell lines showed significant reduction of poly-GP and poly-GA levels by Cas13d-S24 and CRISPR/S30 compared with the non-targeting control Cas13d-NT30. ( C ) Quantification of relative RNA levels of Cas13d in the C9-ALS patient iPSC cell lines showed variable Cas13d levels among lines, while in each line there were no significant differences among the S24, S30, and non-targeting NT30 groups. ( D and E ) Linear regression and correlation analyses showed a strong positive correlation between Cas13d expression level and poly-GP ( D ) and poly-GA ( E ) knockdown efficiency among C9-ALS patient iPSC lines. Pearson’s correlation coefficients and 2-tailed P value were computed. ( F ) Schematic of poly-GP and poly-GA detection in iMNs derived from human C9-ALS patient iPSCs. ( G ) ELISA quantification in iMN lines derived from multiple iPSC cell lines showed significant reduction in poly-GP and poly-GA levels by Cas13d-S24 and CRISPR/S30 compared with the non-targeting control Cas13d-NT30. ( H ) Quantification of relative RNA levels of Cas13d in the C9-ALS patient iMN lines showed variable Cas13d levels among lines, while in each line there were no significant differences among the S24, S30, and non-targeting NT30 groups. ( I and J ) Linear regression and correlation analyses showed a strong positive correlation between Cas13d expression level and poly-GP ( I ) and poly-GA ( J ) knockdown efficiency among C9-ALS patient iMN lines. Pearson’s correlation coefficients and 2-tailed P value were computed. Data are presented as means ± SD of 2–4 biological replicates as indicated by the number of dots in each graph, and were analyzed with ordinary 1-way ANOVA with Dunnett’s multiple-comparison test. * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001.

Techniques: Stable Transfection, Expressing, Transduction, Enzyme-linked Immunosorbent Assay, CRISPR, Control, Knockdown, Derivative Assay, Comparison

( A ) Purified Cas13d showed a nearly 100% degradation efficiency of the target RNA r(NT24) with gRNA NT24 but not the other gRNAs, confirming the specificity and high cleavage activity of the Cas13d system. ( B ) The target RNA r(GGGGCC)2 was too short to be degraded by Cas13d. ( C – E ) The purified Cas13d showed partial degradation of the target RNAs r(GGGGCC)5 ( C ), r(GGGGCC)8 ( D ), and r(GGGGCC)12 ( E ) with gRNA S24 or S30 but not the other gRNAs, indicating a compromised cleavage activity of Cas13d targeting GGGGCC repeat RNAs and a trend of decreased cleavage efficiency with increased repeat lengths. ( F ) Cas13d was unable to degrade r(GGGGCC)28, demonstrating the limited activity of Cas13d to target or cleave longer GGGGCC repeat RNAs. The cleavage assay was performed in a buffer containing 0.3 μM of gRNA, 0.6 μM of Cas13d protein, and 40 ng/μL of target RNA. Data are presented as means ± SD of 3 independent experiments and were analyzed with unpaired 2-tailed Student’s t test ( A ) and ordinary 1-way ANOVA with Dunnett’s multiple-comparison test ( B – F ). * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.001.

Journal: The Journal of Clinical Investigation

Article Title: CRISPR/Cas13d targeting suppresses repeat-associated non-AUG translation of C9orf72 hexanucleotide repeat RNA

doi: 10.1172/JCI179016

Figure Lengend Snippet: ( A ) Purified Cas13d showed a nearly 100% degradation efficiency of the target RNA r(NT24) with gRNA NT24 but not the other gRNAs, confirming the specificity and high cleavage activity of the Cas13d system. ( B ) The target RNA r(GGGGCC)2 was too short to be degraded by Cas13d. ( C – E ) The purified Cas13d showed partial degradation of the target RNAs r(GGGGCC)5 ( C ), r(GGGGCC)8 ( D ), and r(GGGGCC)12 ( E ) with gRNA S24 or S30 but not the other gRNAs, indicating a compromised cleavage activity of Cas13d targeting GGGGCC repeat RNAs and a trend of decreased cleavage efficiency with increased repeat lengths. ( F ) Cas13d was unable to degrade r(GGGGCC)28, demonstrating the limited activity of Cas13d to target or cleave longer GGGGCC repeat RNAs. The cleavage assay was performed in a buffer containing 0.3 μM of gRNA, 0.6 μM of Cas13d protein, and 40 ng/μL of target RNA. Data are presented as means ± SD of 3 independent experiments and were analyzed with unpaired 2-tailed Student’s t test ( A ) and ordinary 1-way ANOVA with Dunnett’s multiple-comparison test ( B – F ). * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.001.

Techniques: Purification, Activity Assay, Cleavage Assay, Comparison

( A ) Schematic of poly-GP and poly-GA detection in mice treated with AAV9 expressing Cas13d and gRNA. ( B and C ) Quantification showed decreased levels of poly-GP ( B ) or poly-GA ( C ) in C9-500 BAC mice but not in the WT mice, when the mice were treated with AAV9 expressing Cas13d-S24 or Cas13d-S30, compared with those treated with control AAV9 expressing the non-targeting Cas13d-NT30. The number of dots in each group indicates the number of mice in the corresponding group. Data are presented as means ± SD and were analyzed with unpaired 1-tailed Student’s t test. * P < 0.05, **** P < 0.0001.

Journal: The Journal of Clinical Investigation

Article Title: CRISPR/Cas13d targeting suppresses repeat-associated non-AUG translation of C9orf72 hexanucleotide repeat RNA

doi: 10.1172/JCI179016

Figure Lengend Snippet: ( A ) Schematic of poly-GP and poly-GA detection in mice treated with AAV9 expressing Cas13d and gRNA. ( B and C ) Quantification showed decreased levels of poly-GP ( B ) or poly-GA ( C ) in C9-500 BAC mice but not in the WT mice, when the mice were treated with AAV9 expressing Cas13d-S24 or Cas13d-S30, compared with those treated with control AAV9 expressing the non-targeting Cas13d-NT30. The number of dots in each group indicates the number of mice in the corresponding group. Data are presented as means ± SD and were analyzed with unpaired 1-tailed Student’s t test. * P < 0.05, **** P < 0.0001.

Techniques: Expressing, Control

Review

Structured Review

Images

Similar Products

Image Search Results